KEGG   Homo sapiens (human): 391627Help
Entry
391627            misc_RNA  T01001                                 

Gene name
USP17L9P, RS447, USP17, USP17A, USP17H, USP17I, USP17J, USP17K, USP17L, USP17M
Definition
ubiquitin specific peptidase 17-like family member 9, pseudogene
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Ensembl: 
Position
4p15
NT seq 1593 nt NT seq  +upstreamnt  +downstreamnt
catggaggacgactcactctacttgagaggtgagtggcagttcaaccacttttcaaaact
cacatcttctcggcccgatgcagcttttgctgaaatccagcggacttctctccctgagaa
gtcaccactctcatgtgagacccgtgtcgacctctgtgatgatttggctcctgtggcaag
acagcttgctcccagggagaagcttcctctgagtagcaggagacctgctgcggtgggggc
tgggctccagaatatgggaaatacctgctacgtgaacgcttccttgcagtgcctgacata
cacaccgccccttgccaactacatgctgtcccgggagcactctcaaacgtgtcatcgtca
caagggctgcatgctctgtactatgcaagctcacatcacacgggccctccacaatcctgg
ccacgtcatccagccctcacaggcattggctgctggcttccatagaggcaagcaggaaga
tgcccatgaatttctcatgttcactgtggatgccatgaaaaaggcatgccttcccgggca
caagcaggtagatcatcactctaaggacaccaccctcatccaccaaatatttggaggcta
ctggagatctcaaatcaagtgtctccactgccacggcatttcagacacttttgaccctta
cctggacatcgccctggatatccaggcagctcagagtgtccagcaagctttggaacagtt
ggtgaagcccgaagaactcaatggagagaatgcctatcattgtggtgtttgtctccagag
ggcgccggcctccaagacgttaactttacacacctctgccaaggtcctcatccttgtatt
gaagagattctccgatgtcacaggcaacaagattgccaagaatgtgcaatatcctgagtg
ccttgacatgcagccatacatgtctcagcagaacacatgacttcttgtctatgtcctcta
tgctgtgctggtccacgctgggtggagttgtcacaacggacattacttctcttatgtcaa
agctcaagaaggccagtggtataaaatggatgatgccgaggtcaccgcctctagcatcac
ttctgtcctgagtcaacaggcctacgtcctcttttacatccagaagagtgaatgggaaag
acacagtgagagtgtgtcaagaggcagggaaccaagagcccttggcgcagaagacacaga
caggcgagcaacgcaaggagagctcaagagagaccacccctgcctccaggcccccgagtt
ggacgagcacttggtggaaagagccactcaggaaagcaccttagaccactggaaattcct
tcaagagcaaaacaaaacgaagcctgagttcaacgtcagaaaagtcgaaggtaccctgcc
tcccgacgtacttgtgattcatcaatcaaaatacaagtgtgggatgaagaaccatcatcc
tgaacagcaaagctccctgctaaacctctcttcgtcgaccccgacacatcaggagtccat
gaacactggcacactcgcttccctgcgagggagggccaggagatccaaagggaagaacaa
acacagcaagagggctctgcttgtgtgccagtg

DBGET integrated database retrieval system