KEGG   Homo sapiens (human): 4549Help
Entry
4549              rRNA      T01001                                 

Gene name
RNR1, MTRNR1, MT-RNR1
Definition
s-rRNA
Orthology
K01979  
small subunit ribosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
Ribosome biogenesis in eukaryotes
Ribosome
Class
Genetic Information Processing; Translation; Ribosome [PATH:hsa03010]
Genetic Information Processing; Translation; Ribosome biogenesis in eukaryotes [PATH:hsa03008]
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 954 nt NT seq  +upstreamnt  +downstreamnt
aataggtttggtcctagcctttctattagctcttagtaagattacacatgcaagcatccc
cgttccagtgagttcaccctctaaatcaccacgatcaaaaggaacaagcatcaagcacgc
agcaatgcagctcaaaacgcttagcctagccacacccccacgggaaacagcagtgattaa
cctttagcaataaacgaaagtttaactaagctatactaaccccagggttggtcaatttcg
tgccagccaccgcggtcacacgattaacccaagtcaatagaagccggcgtaaagagtgtt
ttagatcaccccctccccaataaagctaaaactcacctgagttgtaaaaaactccagttg
acacaaaatagactacgaaagtggctttaacatatctgaacacacaatagctaagaccca
aactgggattagataccccactatgcttagccctaaacctcaacagttaaatcaacaaaa
ctgctcgccagaacactacgagccacagcttaaaactcaaaggacctggcggtgcttcat
atccctctagaggagcctgttctgtaatcgataaaccccgatcaacctcaccacctcttg
ctcagcctatataccgccatcttcagcaaaccctgatgaaggctacaaagtaagcgcaag
tacccacgtaaagacgttaggtcaaggtgtagcccatgaggtggcaagaaatgggctaca
ttttctaccccagaaaactacgatagcccttatgaaacttaagggtcgaaggtggattta
gcagtaaactaagagtagagtgcttagttgaacagggccctgaagcgcgtacacaccgcc
cgtcaccctcctcaagtatacttcaaaggacatttaactaaaacccctacgcatttatat
agaggagacaagtcgtaacatggtaagtgtactggaaagtgcacttggacgaac

DBGET integrated database retrieval system