KEGG   Homo sapiens (human): 4550Help
Entry
4550              rRNA      T01001                                 

Gene name
RNR2, MTRNR2, MT-RNR2
Definition
(RefSeq) l-rRNA
  KO
K01982  
large subunit ribosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
Ribosome biogenesis in eukaryotes
Ribosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    4550 (RNR2)
   03008 Ribosome biogenesis in eukaryotes
    4550 (RNR2)
Ribosome [BR:hsa03011]
 Ribosomal RNAs
  Eukaryotes
   4550 (RNR2)
Non-coding RNAs [BR:hsa03100]
 Ribosomal RNA
  Large subunit rRNA
   4550 (RNR2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 1559 nt NT seq  +upstreamnt  +downstreamnt
gctaaacctagccccaaacccactccaccttactaccagacaaccttagccaaaccattt
acccaaataaagtataggcgatagaaattgaaacctggcgcaatagatatagtaccgcaa
gggaaagatgaaaaattataaccaagcataatatagcaaggactaacccctataccttct
gcataatgaattaactagaaataactttgcaaggagagccaaagctaagacccccgaaac
cagacgagctacctaagaacagctaaaagagcacacccgtctatgtagcaaaatagtggg
aagatttataggtagaggcgacaaacctaccgagcctggtgatagctggttgtccaagat
agaatcttagttcaactttaaatttgcccacagaaccctctaaatccccttgtaaattta
actgttagtccaaagaggaacagctctttggacactaggaaaaaaccttgtagagagagt
aaaaaatttaacacccatagtaggcctaaaagcagccaccaattaagaaagcgttcaagc
tcaacacccactacctaaaaaatcccaaacatataactgaactcctcacacccaattgga
ccaatctatcaccctatagaagaactaatgttagtataagtaacatgaaaacattctcct
ccgcataagcctgcgtcagattaaaacactgaactgacaattaacagcccaatatctaca
atcaaccaacaagtcattattaccctcactgtcaacccaacacaggcatgctcataagga
aaggttaaaaaaagtaaaaggaactcggcaaatcttaccccgcctgtttaccaaaaacat
cacctctagcatcaccagtattagaggcaccgcctgcccagtgacacatgtttaacggcc
gcggtaccctaaccgtgcaaaggtagcataatcacttgttccttaaatagggacctgtat
gaatggctccacgagggttcagctgtctcttacttttaaccagtgaaattgacctgcccg
tgaagaggcgggcataacacagcaagacgagaagaccctatggagctttaatttattaat
gcaaacagtacctaacaaacccacaggtcctaaactaccaaacctgcattaaaaatttcg
gttggggcgacctcggagcagaacccaacctccgagcagtacatgctaagacttcaccag
tcaaagcgaactactatactcaattgatccaataacttgaccaacggaacaagttaccct
agggataacagcgcaatcctattctagagtccatatcaacaatagggtttacgacctcga
tgttggatcaggacatcccgatggtgcagccgctattaaaggttcgtttgttcaacgatt
aaagtcctacgtgatctgagttcagaccggagtaatccaggtcggtttctatctacnttc
aaattcctccctgtacgaaaggacaagagaaataaggcctacttcacaaagcgccttccc
ccgtaaatgatatcatctcaacttagtattatacccacacccacccaagaacagggttt

DBGET integrated database retrieval system