KEGG   Homo sapiens (human): 4555Help
Entry
4555              tRNA      T01001                                 

Gene name
TRND, MTTD, MT-TD
Definition
tRNA-Asp
Orthology
K14221  
tRNA Asp
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    4555 (TRND)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4555 (TRND)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 68 nt NT seq  +upstreamnt  +downstreamnt
aaggtattagaaaaaccatttcataactttgtcaaagttaaattataggctaaatcctat
atatctta

DBGET integrated database retrieval system