KEGG   Homo sapiens (human): 4556Help
Entry
4556              tRNA      T01001                                 

Gene name
TRNE, MTTE, MT-TE
Definition
tRNA-Glu
Orthology
K14224  
tRNA Glu
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    4556 (TRNE)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4556 (TRNE)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 69 nt NT seq  +upstreamnt  +downstreamnt
gttcttgtagttgaaatacaacgatggtttttcatatcattggtcgtggttgtagtccgt
gcgagaata

DBGET integrated database retrieval system