KEGG   Homo sapiens (human): 4563Help
Entry
4563              tRNA      T01001                                 

Gene name
TRNG, MTTG, MT-TG
Definition
tRNA-Gly
Orthology
K14225  
tRNA Gly
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Class
Genetic Information Processing; Translation; Aminoacyl-tRNA biosynthesis [PATH:hsa00970]
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 68 nt NT seq  +upstreamnt  +downstreamnt
actcttttagtataaatagtaccgttaacttccaattaactagttttgacaacattcaaa
aaagagta

DBGET integrated database retrieval system