KEGG   Homo sapiens (human): 4564Help
Entry
4564              tRNA      T01001                                 

Gene name
TRNH, MTTH, MT-TH
Definition
(RefSeq) tRNA-His
  KO
K14226  
tRNA His
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Disease
H00810  
Progressive myoclonic epilepsy (PME/ EPM)
H01347  
MELAS Syndrome
H01356  
Myoclonic Epilepsy and Ragged-Red Fiber Disease
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    4564 (TRNH)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4564 (TRNH)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 69 nt NT seq  +upstreamnt  +downstreamnt
gtaaatatagtttaaccaaaacatcagattgtgaatctgacaacagaggcttacgacccc
ttatttacc

DBGET integrated database retrieval system