KEGG   Homo sapiens (human): 4566Help
Entry
4566              tRNA      T01001                                 

Gene name
TRNK, MTTK, MT-TK, MERRF
Definition
tRNA-Lys
Orthology
K14229  
tRNA Lys
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Disease
H00810  
Progressive myoclonic epilepsy (PME/ EPM)
H01347  
MELAS Syndrome
H01356  
Myoclonic Epilepsy and Ragged-Red Fiber Disease
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    4566 (TRNK)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4566 (TRNK)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 70 nt NT seq  +upstreamnt  +downstreamnt
cactgtaaagctaacttagcattaaccttttaagttaaagattaagagaaccaacacctc
tttacagtga

DBGET integrated database retrieval system