KEGG   Homo sapiens (human): 4566Help
Entry
4566              tRNA      T01001                                 

Gene name
TRNK, MTTK, MT-TK, MERRF
Definition
tRNA-Lys
Orthology
K14229  
tRNA Lys
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Disease
H00810  
Progressive myoclonic epilepsy (PME)
H01347  
MELAS Syndrome
H01356  
Myoclonic Epilepsy and Ragged-Red Fiber Disease
Class
Genetic Information Processing; Translation; Aminoacyl-tRNA biosynthesis [PATH:hsa00970]
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 70 nt NT seq  +upstreamnt  +downstreamnt
cactgtaaagctaacttagcattaaccttttaagttaaagattaagagaaccaacacctc
tttacagtga

DBGET integrated database retrieval system