KEGG   Homo sapiens (human): 4567Help
Entry
4567              tRNA      T01001                                 

Gene name
TRNL1, MTTL1, MT-TL1
Definition
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
hsa  Homo sapiens (human)
Pathway
hsa00970  Aminoacyl-tRNA biosynthesis
Disease
H00810  Progressive myoclonic epilepsy (PME/ EPM)
H01347  MELAS Syndrome
H01356  Myoclonic Epilepsy and Ragged-Red Fiber Disease
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    4567 (TRNL1)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4567 (TRNL1)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 4567
OMIM: 590050
HGNC: 7490
Position
MT
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
gttaagatggcagagcccggtaatcgcataaaacttaaaactttacagtcagaggttcaa
ttcctcttcttaaca

DBGET integrated database retrieval system