KEGG   Homo sapiens (human): 4572Help
Entry
4572              tRNA      T01001                                 

Gene name
TRNQ, MTTQ, MT-TQ
Definition
(RefSeq) tRNA-Gln
  KO
K14223  
tRNA Gln
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Disease
H01347  
MELAS Syndrome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    4572 (TRNQ)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4572 (TRNQ)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
taggatggggtgtgataggtggcacggagaattttggattctcagggatgggttcgattc
tcatagtcctag

DBGET integrated database retrieval system