KEGG   Homo sapiens (human): 4573Help
Entry
4573              tRNA      T01001                                 

Gene name
TRNR, MTTR, MT-TR
Definition
tRNA-Arg
Orthology
K14219  
tRNA Arg
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    4573 (TRNR)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4573 (TRNR)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 65 nt NT seq  +upstreamnt  +downstreamnt
tggtatatagtttaaacaaaacgaatgatttcgactcattaaattatgataatcatattt
accaa

DBGET integrated database retrieval system