KEGG   Homo sapiens (human): 4575Help
Entry
4575              tRNA      T01001                                 

Gene name
TRNS2, MTTS2, MT-TS2
Definition
tRNA-Ser
Orthology
K14233  
tRNA Ser
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Disease
H00810  
Progressive myoclonic epilepsy (PME/ EPM)
H01347  
MELAS Syndrome
H01356  
Myoclonic Epilepsy and Ragged-Red Fiber Disease
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    4575 (TRNS2)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4575 (TRNS2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 59 nt NT seq  +upstreamnt  +downstreamnt
gagaaagctcacaagaactgctaactcatgcccccatgtctaacaacatggctttctca

DBGET integrated database retrieval system