KEGG   Homo sapiens (human): 4576Help
Entry
4576              tRNA      T01001                                 

Gene name
TRNT, MTTT, MT-TT, LIMM
Definition
tRNA-Thr
Orthology
K14234  
tRNA Thr
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    4576 (TRNT)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4576 (TRNT)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 66 nt NT seq  +upstreamnt  +downstreamnt
gtccttgtagtataaactaatacaccagtcttgtaaaccggagatgaaaacctttttcca
aggaca

DBGET integrated database retrieval system