KEGG   Homo sapiens (human): 4576Help
Entry
4576              tRNA      T01001                                 

Gene name
TRNT, MTTT, MT-TT, LIMM
Definition
tRNA-Thr
Orthology
K14234  
tRNA Thr
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Class
Genetic Information Processing; Translation; Aminoacyl-tRNA biosynthesis [PATH:hsa00970]
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 66 nt NT seq  +upstreamnt  +downstreamnt
gtccttgtagtataaactaatacaccagtcttgtaaaccggagatgaaaacctttttcca
aggaca

DBGET integrated database retrieval system