KEGG   Homo sapiens (human): 4578Help
Entry
4578              tRNA      T01001                                 

Gene name
TRNW, MTTW, MT-TW
Definition
tRNA-Trp
Orthology
K14235  
tRNA Trp
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    4578 (TRNW)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4578 (TRNW)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 68 nt NT seq  +upstreamnt  +downstreamnt
agaaatttaggttaaatacagaccaagagccttcaaagccctcagtaagttgcaatactt
aatttctg

DBGET integrated database retrieval system