KEGG   Homo sapiens (human): 4579Help
Entry
4579              tRNA      T01001                                 

Gene name
TRNY, MTTY, MT-TY
Definition
tRNA-Tyr
Orthology
K14236  
tRNA Tyr
Organism
hsa  Homo sapiens (human)
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    4579 (TRNY)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4579 (TRNY)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Position
MT
NT seq 66 nt NT seq  +upstreamnt  +downstreamnt
ggtaaaatggctgagtgaagcattggactgtaaatctaaagacaggggttaggcctcttt
ttacca

DBGET integrated database retrieval system