KEGG   Homo sapiens (human): 534Help
Entry
534               CDS       T01001                                 

Gene name
ATP6V1G2, ATP6G, ATP6G2, NG38, VMA10
Definition
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 (EC:3.6.3.14)
Orthology
K02152  
V-type H+-transporting ATPase subunit G
Organism
hsa  Homo sapiens (human)
Pathway
Oxidative phosphorylation
Metabolic pathways
Phagosome
Synaptic vesicle cycle
Collecting duct acid secretion
Vibrio cholerae infection
Epithelial cell signaling in Helicobacter pylori infection
Rheumatoid arthritis
Module
V-type ATPase, eukaryotes
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Metabolism
  Energy metabolism
   00190 Oxidative phosphorylation
    534 (ATP6V1G2)
 Cellular Processes
  Transport and catabolism
   04145 Phagosome
    534 (ATP6V1G2)
 Organismal Systems
  Excretory system
   04966 Collecting duct acid secretion
    534 (ATP6V1G2)
  Nervous system
   04721 Synaptic vesicle cycle
    534 (ATP6V1G2)
 Human Diseases
  Immune diseases
   05323 Rheumatoid arthritis
    534 (ATP6V1G2)
  Infectious diseases
   05110 Vibrio cholerae infection
    534 (ATP6V1G2)
   05120 Epithelial cell signaling in Helicobacter pylori infection
    534 (ATP6V1G2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Motif Motif
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
6p21.3
AA seq 78 aa AA seqDB search
MASQSQGIQQLLQAEKRAAEKVADARKRKARRLKQATRRQVQGMQSSQQRNRERVLAQLL
GMVCDVRPQVHPNYRISA
NT seq 237 nt NT seq  +upstreamnt  +downstreamnt
atggccagtcagtcccaaggtatccagcagcttctgcaagctgagaagcgggcagctgag
aaggtggcagatgccagaaagaggaaggcccggcgactgaagcaggctacaaggcgccag
gtgcagggcatgcagagctcccagcagagaaaccgagagcgtgtcctggcccagcttctt
ggcatggtctgcgacgtcaggccccaggtccaccccaactaccggatttctgcctag

DBGET integrated database retrieval system