KEGG   Homo sapiens (human): 56475Help
Entry
56475             CDS       T01001                                 

Gene name
RPRM, REPRIMO
Definition
reprimo, TP53 dependent G2 arrest mediator candidate
Orthology
K10128  
reprimo, TP53-dependent G2 arrest mediator candidate
Organism
hsa  Homo sapiens (human)
Pathway
p53 signaling pathway
Class
Cellular Processes; Cell growth and death; p53 signaling pathway [PATH:hsa04115]
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
2q23.3
AA seq 109 aa AA seqDB search
MNPALGNQTDVAGLFLANSSEALERAVRCCTQASVVTDDGFAEGGPDERSLYIMRVVQIA
VMCVLSLTVVFGIFFLGCNLLIKSEGMINFLVKDRRPSKEVEAVVVGPY
NT seq 330 nt NT seq  +upstreamnt  +downstreamnt
atgaatccggccctaggcaaccagacggacgtggcgggcctgttcctggccaacagcagc
gaggcgctggagcgagccgtgcgctgctgcacccaggcgtccgtggtgaccgacgacggc
ttcgcggagggaggcccggacgagcgtagcctgtacataatgcgcgtggtgcagatcgcg
gtcatgtgcgtgctctcactcaccgtggtcttcggcatcttcttcctcggctgcaatctg
ctcatcaagtccgagggcatgatcaacttcctcgtgaaggaccggaggccgtctaaggag
gtggaggcggtggtcgtggggccctactga

DBGET integrated database retrieval system