KEGG   Homo sapiens (human): 6023Help
Entry
6023              ncRNA     T01001                                 

Gene name
RMRP, CHH, NME1, RMRPR, RRP2
Definition
(RefSeq) RNA component of mitochondrial RNA processing endoribonuclease
  KO
K14576  
small nucleolar RNA MRP
Organism
hsa  Homo sapiens (human)
Pathway
Ribosome biogenesis in eukaryotes
Disease
H00107  
Other well-defined immunodeficiency syndromes
H00479  
Metaphyseal dysplasias
H00518  
RMRP related disorders
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   03008 Ribosome biogenesis in eukaryotes
    6023 (RMRP)
Ribosome biogenesis [BR:hsa03009]
 Related small nucleolar RNAs
  Other snoRNA
   6023 (RMRP)
Non-coding RNAs [BR:hsa03100]
 Small nucleolar RNA
  Other snoRNA
   6023 (RMRP)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Ensembl: 
Position
9p13.3
NT seq 277 nt NT seq  +upstreamnt  +downstreamnt
ggttcgtgctgaaggcctgtatcctaggctacacactgaggactctgttcctcccctttc
cgcctaggggaaagtccccggacctcgggcagagagtgccacgtgcatacgcacgtagac
attccccgcttcccactccaaagtccgccaagaagcgtatcccgctgagcggcgtggcgc
gggggcgtcatccgtcagctccctctagttacgcaggcagtgcgtgtccgcgcaccaacc
acacggggctcattctcagcgcggctgtaaaaaaaaa

DBGET integrated database retrieval system