KEGG   Homo sapiens (human): 6023Help
Entry
6023              ncRNA     T01001                                 

Gene name
RMRP, CHH, NME1, RMRPR, RRP2
Definition
RNA component of mitochondrial RNA processing endoribonuclease
Organism
hsa  Homo sapiens (human)
Disease
H00107  
Other well-defined immunodeficiency syndromes
H00479  
Metaphyseal dysplasias
H00518  
RMRP related disorders
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Ensembl: 
Position
9p21-p12
NT seq 277 nt NT seq  +upstreamnt  +downstreamnt
ggttcgtgctgaaggcctgtatcctaggctacacactgaggactctgttcctcccctttc
cgcctaggggaaagtccccggacctcgggcagagagtgccacgtgcatacgcacgtagac
attccccgcttcccactccaaagtccgccaagaagcgtatcccgctgagcggcgtggcgc
gggggcgtcatccgtcagctccctctagttacgcaggcagtgcgtgtccgcgcaccaacc
acacggggctcattctcagcgcggctgtaaaaaaaaa

DBGET integrated database retrieval system