KEGG   Homo sapiens (human): 7012Help
Entry
7012              ncRNA     T01001                                 

Gene name
TERC, DKCA1, PFBMFT2, SCARNA19, TR, TRC3, hTR
Definition
telomerase RNA component
Organism
hsa  Homo sapiens (human)
Disease
H00507  
Dyskeratosis congenita (DC)
H01132  
Aplastic anemia (AA)
H01299  
Idiopathic pulmonary fibrosis
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
OMIM: 
HGNC: 
Ensembl: 
Position
3q26
NT seq 451 nt NT seq  +upstreamnt  +downstreamnt
gggttgcggagggtgggcctgggaggggtggtggccattttttgtctaaccctaactgag
aagggcgtaggcgccgtgcttttgctccccgcgcgctgtttttctcgctgactttcagcg
ggcggaaaagcctcggcctgccgccttccaccgttcattctagagcaaacaaaaaatgtc
agctgctggcccgttcgcccctcccggggacctgcggcgggtcgcctgcccagcccccga
accccgcctggaggccgcggtcggcccggggcttctccggaggcacccactgccaccgcg
aagagttgggctctgtcagccgcgggtctctcgggggcgagggcgaggttcaggcctttc
aggccgcaggaagaggaacggagcgagtccccgcgcgcggcgcgattccctgagctgtgg
gacgtgcacccaggactcggctcacacatgc

  All links  
No link information was found.   
DBGET integrated database retrieval system