KEGG   Homo sapiens (human): 780852Help
Entry
780852            ncRNA     T01001                                 

Gene name
SNORD3B-2, U3-2B, U3b2
Definition
(RefSeq) small nucleolar RNA, C/D box 3B-2
  KO
K14483  
U3 small nucleolar RNA
Organism
hsa  Homo sapiens (human)
Pathway
Ribosome biogenesis in eukaryotes
RNA transport
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Genetic Information Processing
  Translation
   03013 RNA transport
    780852 (SNORD3B-2)
   03008 Ribosome biogenesis in eukaryotes
    780852 (SNORD3B-2)
Ribosome biogenesis [BR:hsa03009]
 Related small nucleolar RNAs
  Box C/D snoRNAs
   SnoRNAs involved in processing reactions
    780852 (SNORD3B-2)
Non-coding RNAs [BR:hsa03100]
 Small nucleolar RNA
  Box C/D snoRNAs
   780852 (SNORD3B-2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
HGNC: 
Ensembl: 
Position
17p11.2
NT seq 217 nt NT seq  +upstreamnt  +downstreamnt
aagactatactttcagggatcatttctatagtgtgttactagagaagtttctctgaacgt
gtagagcaccgaaaaccccgaggaagagaggtagcgttttctcctgagcgtgaagccggc
tttctggcgttgcttggctgcaactgccgtcagccattgatgatcgttcttctctccgta
ttggggagtgagagggagagaacgcggtctgagtggt

DBGET integrated database retrieval system