KEGG   Homo sapiens (human): 79002Help
Entry
79002             CDS       T01001                                 

Gene name
C19orf43, fSAP18
Definition
chromosome 19 open reading frame 43
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
19p13.2
AA seq 176 aa AA seqDB search
MAARGRRAEPQGREAPGPAGGGGGGSRWAESGSGTSPESGDEEVSGAGSSPVSGGVNLFA
NDGSFLELFKRKMEEEQRQRQEEPPPGPQRPDQSAAAAGPGDPKRKGGPGSTLSFVGKRR
GGNKLALKTGIVAKKQKTEDEVLTSKGDAWAKYMAEVKKYKAHQCGDDDKTRPLVK
NT seq 531 nt NT seq  +upstreamnt  +downstreamnt
atggctgcccgagggagacgggcggagcctcagggccgggaggctccgggccccgcgggc
ggtggcggtggcgggagccgttgggctgagtcgggatcggggacgtcgcccgagagcggg
gacgaggaggtgtcgggcgcgggttcgagcccggtgtcgggcggcgtgaacttgttcgcc
aacgacggcagcttcctggagctgttcaagcggaagatggaggaggagcagcggcagcgg
caggaggagccgcccccgggtccgcagcgacccgaccagtcggccgccgccgctggcccc
ggggatccgaagaggaagggcggtccgggctccacacttagcttcgtgggcaaacgcaga
ggcgggaacaaactagccctcaagacgggaatagtagccaagaagcagaagacggaggat
gaggtattaacaagtaaaggtgacgcgtgggccaagtacatggcagaagtgaaaaagtac
aaagctcaccagtgcggtgacgatgataaaactcggcccctggtgaaatga

DBGET integrated database retrieval system