KEGG   Homo sapiens (human): 79647Help
Entry
79647             CDS       T01001                                 

Gene name
AKIRIN1, C1orf108, STRF2
Definition
(RefSeq) akirin 1
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
1p34.3
AA seq 192 aa AA seqDB search
MACGATLKRPMEFEAALLSPGSPKRRRCAPLPGPTPGLRPPDAEPPPPFQTQTPPQSLQQ
PAPPGSERRLPTPEQIFQNIKQEYSRYQRWRHLEVVLNQSEACASESQPHSSALTAPSSP
GSSWMKKDQPTFTLRQVGIICERLLKDYEDKIREEYEQILNTKLAEQYESFVKFTHDQIM
RRYGTRPTSYVS
NT seq 579 nt NT seq  +upstreamnt  +downstreamnt
atggcgtgcggggcgacgctgaagcggcccatggagttcgaggcggcgctgctgagcccc
ggctccccgaagcggcggcgctgcgcccctctgcccggccccactccgggcctcaggccc
ccggacgccgagccgccgccgccgtttcagacgcagaccccaccgcagagtctgcagcag
cccgccccgcccggcagcgagcggcgccttccaactccggagcaaatttttcagaacata
aaacaagaatatagtcgttatcagaggtggagacatttagaagttgttcttaatcagagt
gaagcttgtgcttcggaaagtcaacctcactcctcagcactcacagcacctagctctcca
ggttcctcatggatgaagaaggaccagcccacatttaccctccgacaagttggcataata
tgtgagcgcctcttaaaagactatgaagataaaattcgggaggagtatgagcaaatcctc
aataccaaactagcagaacaatatgaatcttttgtgaaattcacacatgatcagattatg
cgacggtatgggacaaggccaacaagctatgtgtcatga

DBGET integrated database retrieval system