KEGG   Homo sapiens (human): 84516Help
Entry
84516             CDS       T01001                                 

Gene name
DCTN5
Definition
dynactin 5 (p25)
Orthology
K10427  
dynactin 5
Organism
hsa  Homo sapiens (human)
Pathway
Vasopressin-regulated water reabsorption
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Organismal Systems
  Excretory system
   04962 Vasopressin-regulated water reabsorption
    84516 (DCTN5)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
UniProt: 
Position
16p12.2
AA seq 84 aa AA seqDB search
MELGELLYNKSEYIETASGNKVSRQSVLCGSQNIVLNGKNFVISVFLSPYIRCHSACRDR
KRSDESVRLSVNNREWWGLVNWRM
NT seq 255 nt NT seq  +upstreamnt  +downstreamnt
atggagttgggcgagctgctctacaacaagtctgagtacatcgagacggcatctgggaac
aaagtcagtcgccagtcagtgttgtgtggaagccagaacatcgttctcaatggcaagaac
tttgtcatttctgttttcctgagcccatatatcagatgtcacagtgcctgcagggataga
aagagatcagatgagtcagtaagactgagtgtgaacaatagagagtggtggggcctggtg
aattggagaatgtga

DBGET integrated database retrieval system