KEGG   Homo sapiens (human): 90070Help
Entry
90070             CDS       T01001                                 

Gene name
LACRT
Definition
(RefSeq) lacritin
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 90070
NCBI-ProteinID: NP_150593
OMIM: 607360
HGNC: 16430
Ensembl: ENSG00000135413
Vega: OTTHUMG00000169936
Pharos: Q9GZZ8(Tbio)
UniProt: Q9GZZ8
Position
12q13.2
AA seq 138 aa AA seqDB search
MKFTTLLFLAAVAGALVYAEDASSDSTGADPAQEAGTSKPNEEISGPAEPASPPETTTTA
QETSAAAVQGTAKVTSSRQELNPLKSIVEKSILLTEQALAKAGKGMHGGVPGGKQFIENG
SEFAQKLLKKFSLLKPWA
NT seq 417 nt NT seq  +upstreamnt  +downstreamnt
atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaa
gatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcct
aatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaacagcc
caggagacttcggcggcagcagttcaggggacagccaaggtcacctcaagcaggcaggaa
ctaaaccccctgaaatccatagtggagaaaagtatcttactaacagaacaagcccttgca
aaagcaggaaaaggaatgcacggaggcgtgccaggtggaaaacaattcatcgaaaatgga
agtgaatttgcacaaaaattactgaagaaattcagtctattaaaaccatgggcatga

DBGET integrated database retrieval system