KEGG   Homo sapiens (human): 90070Help
Entry
90070             CDS       T01001                                 

Gene name
LACRT
Definition
(RefSeq) lacritin
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
OMIM: 
HGNC: 
Ensembl: 
Vega: 
Pharos: 
Q9GZZ8(Tbio)
UniProt: 
Position
12q13.2
AA seq 138 aa AA seqDB search
MKFTTLLFLAAVAGALVYAEDASSDSTGADPAQEAGTSKPNEEISGPAEPASPPETTTTA
QETSAAAVQGTAKVTSSRQELNPLKSIVEKSILLTEQALAKAGKGMHGGVPGGKQFIENG
SEFAQKLLKKFSLLKPWA
NT seq 417 nt NT seq  +upstreamnt  +downstreamnt
atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaa
gatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcct
aatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaacagcc
caggagacttcggcggcagcagttcaggggacagccaaggtcacctcaagcaggcaggaa
ctaaaccccctgaaatccatagtggagaaaagtatcttactaacagaacaagcccttgca
aaagcaggaaaaggaatgcacggaggcgtgccaggtggaaaacaattcatcgaaaatgga
agtgaatttgcacaaaaattactgaagaaattcagtctattaaaaccatgggcatga

DBGET integrated database retrieval system