KEGG   Homo sapiens (human): 94235Help
Entry
94235             CDS       T01001                                 

Gene name
GNG8
Definition
guanine nucleotide binding protein (G protein), gamma 8
Orthology
K04544  
guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-8
Organism
hsa  Homo sapiens (human)
Pathway
Ras signaling pathway
Chemokine signaling pathway
PI3K-Akt signaling pathway
Circadian entrainment
Retrograde endocannabinoid signaling
Glutamatergic synapse
Cholinergic synapse
Serotonergic synapse
GABAergic synapse
Dopaminergic synapse
Morphine addiction
Alcoholism
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Environmental Information Processing
  Signal transduction
   04014 Ras signaling pathway
    94235 (GNG8)
   04151 PI3K-Akt signaling pathway
    94235 (GNG8)
 Organismal Systems
  Immune system
   04062 Chemokine signaling pathway
    94235 (GNG8)
  Nervous system
   04724 Glutamatergic synapse
    94235 (GNG8)
   04727 GABAergic synapse
    94235 (GNG8)
   04725 Cholinergic synapse
    94235 (GNG8)
   04728 Dopaminergic synapse
    94235 (GNG8)
   04726 Serotonergic synapse
    94235 (GNG8)
   04723 Retrograde endocannabinoid signaling
    94235 (GNG8)
  Environmental adaptation
   04713 Circadian entrainment
    94235 (GNG8)
 Human Diseases
  Substance dependence
   05032 Morphine addiction
    94235 (GNG8)
   05034 Alcoholism
    94235 (GNG8)
GTP-binding proteins [BR:hsa04031]
 Heterotrimeric G-proteins
  Gamma Subunits
   Gamma [OT]
    94235 (GNG8)
BRITE hierarchy
SSDB OrthologParalogGFIT
Motif
Pfam: 
Motif
Other DBs
NCBI-GI: 
NCBI-GeneID: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
19q13.32
AA seq 70 aa AA seqDB search
MSNNMAKIAEARKTVEQLKLEVNIDRMKVSQAAAELLAFCETHAKDDPLVTPVPAAENPF
RDKRLFCVLL
NT seq 213 nt NT seq  +upstreamnt  +downstreamnt
atgtccaacaacatggccaagattgccgaggcccgcaagacggtggaacagctgaagctg
gaggtgaacatcgaccgcatgaaggtgtcgcaggcagcagcggaactcctggctttctgc
gagacgcatgccaaagatgacccgctggtgacgccagtacccgccgcggagaaccccttc
cgcgacaagcgcctcttttgtgttctgctctga

DBGET integrated database retrieval system