KEGG   Haloquadratum walsbyi C23: Hqrw_1415Help
Entry
Hqrw_1415         gene      T01942                                 

Gene name
thrC3
Definition
pseudogene
Organism
hwc  Haloquadratum walsbyi C23
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
440468..442469
Genome map
NT seq 2002 nt NT seq  +upstreamnt  +downstreamnt
atgtcagcattaccgacatcacttcaattatgctgtcatgtatgtggtcaacaatataac
gataggtgggtatggcggtgtcattgtggttcgcccttggatttcgccgtttcacagact
ccagacggcgaaccacctgcgtcaccgacatggagagataccaccgatggactttgggca
ttcacagacctgcttccggttgagcctacggtctcccttggtgagggattaaccccactt
gtgaacccactctaaggtcaagccccggggcttcctgcctcaacgacgttgtcagactgc
gtctgacagcccaccagacggagtctggtgaacgcactttgcatccacacgctctcgctg
aggtgtgaacgtagggagcgcagtctgcacaggtcgttcgaaaatcgaagattttcgtga
tcacgagagacttcgtatctcggacgacgttaattcggagcgtcccgcccctaactgctt
caaaccacgattaagaatattcttcgctgcgttcaactcacggtcttcagtatgaccgca
cgcaggacaggagtgctctcgcacccaaatcggtttttccgtctcaacactacacacagc
acactctttggtcgtcccttccggtttcaccttctcaacatgggtgccatgtaggtcagc
cttgtactccagcaactcgataaatcgtgaccacgcggcatcttgcttgtttttcgcgtt
ctggctcgtttccagcattggcttcacgtctacgtctaggtcttcgacagccacaacgtc
gtactcttgcaccagccacgtcgtgagtttgtgctggtagttacgcatcttccgcttaat
tgctcgtttcgcttgagcgacctttcggtgttgcttctcccagttactcgagccgtgttc
ttttcgtgagagtttccgttgctcgcgggcgtaacggtcgtactcatccgacaggtcaag
tgtacccacggacaggttttcagaggtgtagatgtagctcgtgataccgaggtcaacacc
aatacagtcgtctgggtcaatctcggtgagtggcggtttctcaggtgtgtcttcgacagt
ggtgacgagtgagacgtaccactcaccggtcggctctttcttgaggattccctcatcaat
atcgcccgctggtggtacgtcacgatttgcacgtattttgaaccagccgattttttcgag
tcggagtcgcacgaatccctcatcgcccgtgttgtgatccacgttgaagcgactagactg
attgtacgacaccgaccgaaactcaccacgaccttgccaacgcaaccgcccgacatcgga
gtgaaatatatattccagcgtcaatcaagccagcaaaacgacgggcaattgaacgcactg
gggcaacgccgattagtatcgaaggatctcgtgagcaagtcacaaaagcgtgtattgaaa
ccgtgaagtccgatgaggcgtggtatgcctcacatgcatggaatcccgccttctttgcgg
agacagcaacatttgctgaagtatgtgcacagcgtggatggagtgcaccagacgtcgttg
taatgccacttggtcacggtacattattccttgacgcatatcgtggctttgttgatctgt
tgaacgcgggatggattgactcactcccgcgactccttgtgcacaggcgactggacatgc
accaatcgcacgtgagcttcatgacatttcaacagcgccgacaaaagtgaataaccgtgt
tgatggaatccagattgcggaacctgtccgccgtaagcagatccttacagctattaattc
cactgatggtgatgcaattgcactttccgctgatgttgttgatacgacagtcgatgcact
tcacgcccggggattctatactgagcccacctgtgcaattgccccggctgcacttgacat
ctatcgggatcgggagataattgcagctcatgatgatgttgtggttccactcactggaag
cgggctgaagacgactatataa

DBGET integrated database retrieval system