KEGG   Candidatus Kinetoplastibacterium blastocrithidii (ex Strigomonas culicis): CKBE_00301Help
Entry
CKBE_00301        CDS       T02427                                 

Definition
hypothetical protein
Orthology
K06187  
recombination protein RecR
Organism
kbl  Candidatus Kinetoplastibacterium blastocrithidii (ex Strigomonas culicis)
Pathway
Homologous recombination
Brite
KEGG Orthology (KO) [BR:kbl00001]
 Genetic Information Processing
  Replication and repair
   03440 Homologous recombination
    CKBE_00301
DNA repair and recombination proteins [BR:kbl03400]
 Prokaryotic Type
  DSBR (double strand breaks repair)
   NHEJ (non-homologous end-joining)
    SHDIR (short-homology-dependent illegitimate recombination)
     RecET pathway
      CKBE_00301
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif Motif
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
326271..326549
Genome map
AA seq 92 aa AA seqDB search
MGRVSPLNGIGPRELSFQRILDRATDGIVEEVIIATSFTAEGETTAQFLVSMLSEHNIKT
TRLARGVPAGSELEYIDAGTIAWALVDRREVV
NT seq 279 nt NT seq  +upstreamnt  +downstreamnt
atgggtagagtttctcctttaaacggtataggtccgagagagttaagttttcagcgcatt
ttagacagagcaacagatggaattgttgaagaggtaattatagcaacaagctttactgct
gagggtgaaactactgctcaattcttagtaagcatgctttctgagcataatataaaaact
actagattagctagaggggtgccagctggaagcgagttagagtatatagatgctggcaca
atagcctgggctcttgttgatagaagagaagttgtataa

DBGET integrated database retrieval system