KEGG   Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365: LBUL_0059Help
Entry
LBUL_0059         CDS       T00419                                 

Definition
glycosidase
Orthology
K00690  
sucrose phosphorylase [EC:2.4.1.7]
Organism
lbu  Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Pathway
Starch and sucrose metabolism
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:lbu00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
55747..56733
Genome map
AA seq 328 aa AA seqDB search
MWNTFGPDQIDLDVRTEVTKRFVKETLQQLVKHQASLIRLDAFAYAVKKLDTSDFFVEPE
IWDLLDGVRQDLAGTDAQILPEIHEHYSLPRKVSEHGYFIYDFALPMVLLYSLYTGKSQR
LAAWLKQCPMKQFTILDTHDGLGVVDSKDILTDEEIDYTTQELYKIGANVKRKYSSAEYN
NLDIYQSNTTYYSALGNDDQKYFLARLLQVFAPGIPQICYVGLLAGENDLDLLERTKEGR
NINRHYYSLEEIDQEVKRPVVAKLLKLLESRNTEAAFDLDGRLEVAAPSEHEIVLKRVNQ
AGDREAVFRVDLTALTYQISVNGEEISL
NT seq 987 nt NT seq  +upstreamnt  +downstreamnt
atgtggaatacttttggccccgaccagatcgacctggacgtgcggaccgaagttaccaag
cgttttgtcaaggaaaccctccagcagctggtcaagcaccaggccagcttgatccggctg
gatgcctttgcttacgcggttaagaaactggacacgagcgacttcttcgttgaacctgaa
atctgggacctgctggatggagtccgccaggacctggctggaacagacgcgcaaatttta
ccggaaatccatgaacactatagcttgccgcgcaaggtcagcgagcatggctactttatc
tatgactttgccctgccgatggtcctgctctattccctgtatactggcaagagccaaagg
ctggccgcctggctgaagcagtgcccgatgaagcagtttactatcctggacacccatgac
ggcttgggggtggttgactccaaggacattttgactgatgaggaaattgactacacgacc
caggaactgtacaagatcggggctaacgtcaagcggaaatactcttcagctgagtacaac
aatttggacatttaccaaagcaatacgacctattactcagccctgggcaatgatgaccaa
aaatacttcctggcccggctgctgcaagtttttgccccggggattccgcaaatctgctat
gttggcctgctggccggggaaaacgacctggacctgctggaacggaccaaggaaggccgg
aacatcaaccgccactactacagcctggaagaaattgaccaggaagttaagcggccagtc
gttgccaagcttttgaaattgctggaatctagaaatactgaagcggcatttgacctggat
ggccggctggaagttgctgctccaagcgagcatgagattgtcttaaagcgggtaaaccag
gctggggaccgggaagcggttttccgggtggacctgactgccttgacttaccagatcagc
gtcaatggtgaggaaatttccctgtaa

DBGET integrated database retrieval system