KEGG   Lactobacillus delbrueckii subsp. bulgaricus 2038: LBU_0042Help
Entry
LBU_0042          CDS       T01957                                 

Definition
sucrose phosphorylase
Orthology
K00690  
sucrose phosphorylase [EC:2.4.1.7]
Organism
ldl  Lactobacillus delbrueckii subsp. bulgaricus 2038
Pathway
Starch and sucrose metabolism
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:ldl00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
47807..48943
Genome map
AA seq 378 aa AA seqDB search
MAVGEMAPAQALVEQLAGQGRQVLNRLLNGQQVRKKLRTKLEPSKRENVEYFWPRPDRPG
RADRSYQAFCQGNHPTIQQLVKHQASLIRLDAFAYAVKKLDTSDFFVEPEIWDLLDEVRQ
DLAGTDAQILPEIHEHYSLPRKVSEHGYFIYDFALPMVLLYSLYTGKSQRLAAWLKQCPM
KQFTTLDTHDGLGVVDAKDILTDEEIDYTTQELYKIGANVKRKYSSAEYNNLDIYQSNTT
YYSALGNDDQKYFLARLLQVFAPGIPQIYYVGLLAGENDLDLLERTKEGRNINRHYYSLE
EIDQEVKRPVVAKLLKLLESRNTEAAFDLDGRLEVAAPSEHEIVLKRVNQAGDREAVLRV
DLTALTYQISVNGEEISL
NT seq 1137 nt NT seq  +upstreamnt  +downstreamnt
atggccgttggggaaatggccccggcgcaggcgctggttgagcaactggcaggtcagggc
cgccaggtccttaatcggctgcttaacggtcagcaggtccggaaaaaattgcggacaaaa
ttggagccgtcaaaacgagaaaatgtggaatacttttggccccgaccagatcgacctgga
cgtgcggaccgaagttaccaagcgttttgtcaaggaaaccatccaaccatccagcagctg
gtcaagcaccaggccagcttgatccggctggatgcctttgcttacgcggttaagaaactg
gacacgagcgacttcttcgttgaacctgaaatctgggacctgctggatgaagtccgccag
gacctggctggaacagacgcgcaaattttaccggaaatccatgaacactatagcttgccg
cgcaaggtcagcgagcatggctactttatctatgactttgccctgccgatggtcctgctc
tattccctgtatactggcaagagccaaaggctggccgcctggctgaagcagtgcccgatg
aagcagtttactaccctggacacccatgacggcttgggggtggttgacgccaaggacatt
ttgactgatgaggaaattgactacacgacccaggaactgtacaagatcggggctaacgtc
aagcggaaatactcttcagctgagtacaacaatttggacatttaccaaagcaatacgacc
tattactcagccctgggcaatgatgaccaaaagtacttcctggcccggctgctgcaagtt
tttgccccggggattccgcaaatctactatgttggcctgctggccggggaaaacgacctg
gacctgctggaacggaccaaggaaggccggaacatcaaccgccactactacagcctggaa
gaaattgaccaggaagttaagcggccagtcgttgccaagcttttgaaattgctggaatct
agaaatactgaagcggcctttgacctggatggccggctggaagttgctgctccaagcgag
catgagattgtcttaaagcgggtcaaccaggctggggaccgggaagcggttctccgggtg
gacctgactgccttgacttaccagatcagcgtcaacggtgaggaaatttccctgtaa

DBGET integrated database retrieval system