KEGG   Lactococcus lactis subsp. lactis Il1403: L93919Help
Entry
L93919            gene      T00045                                 

Definition
pseudogene
Organism
lla  Lactococcus lactis subsp. lactis Il1403
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
693909..695912
Genome map
NT seq 2004 nt NT seq  +upstreamnt  +downstreamnt
atgctcaccaataatttttcaattgaaccttacggaaaaaaagcttaccatacagggata
gcagttccagttttttcactaagaactgaaaactcaagtggggtagggcaattttcagat
ttgaaagagttagccgattttgcccaccgttctgggatggacatcattcaattattacca
attaatgataccagtacttttatggactggcgtgattcatatccttatcgtgccatttct
gtttttgcattgcatccaatttatttagatattcacatcttttgggattcttacacaaaa
attcaacaagaaaagcttctcatcgcggaattagaattaaatgctttagaaaaaatagat
tatgaaaaagcattagccttaaaatgggaatatgctgaaattatttatcaaaactcagct
cataaatttaaagcaagcaaagattatcagcaattttatcagcaaaatgaggattgatta
aaggcctatgcggcattttcgtatttaagagatatcaatcaaagtgctaattttatgaat
tggggaaagtatgccacttatagtgaagatttctttgaaaagttaacttcagaaagtaat
caattggatttgtatatctttgtgcaataccttttgcattatcaactttcagaagccgtt
gactattgtcatcaattaggaattgcactaaaaggagatatcgcaattggaattgctcat
gattccgtagacgcttggactcatccagaactttttcatcttgataaacaagctggcgct
cctcctgatatttttgctgtaaatggacaaaattggggctttccaacctacaattggaaa
aaaatggccgaagatggttatgcatggtggaaaaaacggttaacagccatgtctaattat
tttgatgcttatcggctggaccatattcttggtttctttagaatatggcagatgccagag
gattccgtaagaggtttattgggccaattttcaccagctattgccttgtcagcagaagaa
attgaaaatagctatggtattccattaaggcaatggggcctcgagcggtttattaatcct
ttcatcaaggattgggtaattgatgaaatttttggccgagataatcgagattggattatt
caaacatttctggattatataggtaatggaaattatacatttcaaaatgagtataataac
cagaaaaaagtagaaaaagctcaattagaagattgggtgcgagaaggactttataaatta
catgaaaatataatattattaaaagatgatgagaatccagagaaatatcatccacgtatt
tctttaatacaaacaatcagctttcgagaatttggtgatgactataaaggacggcttgaa
aaactttataatgactatttttatggaaggaattatgaattttggaaagaaaaggcctat
gaaaaattaccagttttaaaagatgctacgaatatgttggcttgtggtgaagatttagga
atggttcccgccaatgtaccagatgtcatgaatcatcttaatattctacgtttgataatt
gagagaatgccttcagataatcgatttgtcagtcctttaaacgaagttccctatttatcg
gtcctaacgacttcaagtcacgatacaagtccactaagagcttggtgggaagaaaatcat
gaggaaattcaacgttactacaatgaagtcatgggttggtatggcgaagctccttattat
gcaagtgcagaaattatccaagagatagttaaaaggcatttaaactccaatgcgatgatg
gttatcttacctattcaagattggttagcaatgagtgaacaattgcgaaaagaagatgca
aaatccgaacaaattaatattccagcaaatccataccattactggaattaccgattgcat
tgtcaacttgaaacattgattgataatcaggattggactgaatttttaaagaaatttatc
aaagaaagtaaaagagcctattaa

DBGET integrated database retrieval system