KEGG   Legionella longbeachae: LLO_3013Help
Entry
LLO_3013          gene      T01183                                 

Definition
(GenBank) pseudogene
Organism
llo  Legionella longbeachae
SSDB OrthologParalogGene clusterGFIT
Other DBs
Pasteur: 
Position
complement(3507855..3508205)
Genome map
NT seq 351 nt NT seq  +upstreamnt  +downstreamnt
atgaagtcgatgtccagtgaaatcagtgaaataaatcttttaaagaatgcccaatttact
gtatatcaacaaaaatgggattcgcgaagctctgttcgttctcgtcccgagaagtgcatt
gattttagtcttgaaagttattttttccctagcgacaaacaacctattttactcagtgaa
gaggttcatgcattaggcgaatcggtaaaaaaggacatactgctccaatcatttttcaaa
tacttaaatgatattgttcatcttgaagtgaagcttatcaatcaagcctgtcatcttatc
attgcacgagcttcgcacattcctaaaaatggattaaaatacgcgtcataa

DBGET integrated database retrieval system