KEGG   Listeria monocytogenes N53-1: BN419_1071Help
Entry
BN419_1071        CDS       T02513                                 

Definition
Protoporphyrinogen oxidase
Orthology
K00231  
oxygen-dependent protoporphyrinogen oxidase [EC:1.3.3.4]
Organism
lmob  Listeria monocytogenes N53-1
Pathway
Porphyrin and chlorophyll metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Brite
KEGG Orthology (KO) [BR:lmob00001]
 Metabolism
  Metabolism of cofactors and vitamins
   00860 Porphyrin and chlorophyll metabolism
    BN419_1071
Enzymes [BR:lmob01000]
 1. Oxidoreductases
  1.3  Acting on the CH-CH group of donors
   1.3.3  With oxygen as acceptor
    1.3.3.4  protoporphyrinogen oxidase
     BN419_1071
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
854075..854593
Genome map
AA seq 172 aa AA seqDB search
MRPEDHLSSKSASSDSRRLCDGNSDRQRGTASKARALQEPTMERNNQEQDQALGDFFEAR
FGKELVKTIIEPLLSGIYAGDIYKMSLRATFPQFEQTVKKYGNLMDGLKESSMQTTIGAF
RTLEGGLDQKPLRPHFQKKTCIQQNKQLTKSRLQMAIKWKQMASLLLPHMMR
NT seq 519 nt NT seq  +upstreamnt  +downstreamnt
atgcgaccggaagatcatttatcatcaaaaagcgcttcatccgattccagaaggctctgt
gatgggaattccgacagacaaagaggcactgctagcaaagcacgagcacttcaagaacca
acaatggaacggaataatcaagaacaagatcaagcacttggcgatttctttgaagcgcga
ttcggtaaggaattagtcaaaacaattatcgaaccacttttatcaggaatttatgccggg
gatatatacaaaatgagtttacgcgccacttttccacaatttgaacaaacggttaaaaaa
tatggaaatttgatggatggtttgaaagaaagcagcatgcaaacgactattggcgctttt
cgaacattagaaggtgggctagaccaaaagccattgcggccgcacttccaaaagaaaact
tgcatacagcaaaacaagcaacttacgaaatctcgtttgcagatggcgataaaatggaag
cagatggcgtcattattgctgccacacatgatgcgttaa

DBGET integrated database retrieval system