KEGG   Listeria monocytogenes N53-1: BN419_3387Help
Entry
BN419_3387        CDS       T02513                                 

Definition
Putative sucrose phosphorylase
Orthology
K00690  
sucrose phosphorylase [EC:2.4.1.7]
Organism
lmob  Listeria monocytogenes N53-1
Pathway
Starch and sucrose metabolism
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:lmob00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
complement(2759731..2760618)
Genome map
AA seq 295 aa AA seqDB search
MPHVDNISYFGNGEKEAHMVYQFPLPPLVLHAIHHGNAKFLRNWAKNLELPEGKRTFFNF
LASHDGIGLNPVRRIIPEAEILALVNDLEEEGALVSYKQNPDGSKSPYEINVTYMDALSK
QADTDDLRLARFLVAHAVLMSIPGVPAVYVQSILGSRNDYLGVEATSHNRSINRKKYDLA
EITAELEQRGSLRKATYDALTKLISTRKAESLFHPEIPMEVLESTAELFVVKRSSDAESI
ILIHNLSEKEVSYSLDSGVYTNLYKGSTVTGSDSIKLSGYEFCWLKTKNYREEQK
NT seq 888 nt NT seq  +upstreamnt  +downstreamnt
gtgccgcatgttgataatattagttattttggaaatggtgaaaaagaagcgcatatggtt
tatcaattcccgcttccaccacttgtgctccatgctatccatcatggtaatgcaaaattc
ctccgtaactgggcgaagaatttagagctaccagaaggcaagcggacattctttaatttc
cttgcctcacatgatgggattgggttaaatccagtgcgcagaattattccagaagctgag
attttggctttagtgaatgatttggaggaagaaggtgcgctcgtttcttacaagcaaaat
ccagatggttctaagagtccttatgaaataaacgtgacgtacatggatgcgctaagtaaa
caggcggacacagatgatttgcgacttgcaagattccttgtggctcatgcagtattgatg
tctatcccaggcgttccagccgtttatgttcaaagtattttaggaagccgcaatgattat
ttaggcgtagaagcaacaagtcacaatcgctctattaatcgaaaaaaatacgacttggcg
gaaattacagcagagttggaacaaagaggctccttacgaaaagcaacttatgatgcgcta
acgaaattaattagcacacgaaaagcggaatcacttttccatccagaaataccgatggaa
gttttagaatctacggcggaattgtttgttgttaaacgttcatccgacgcagaatcgatt
atattgattcataatttatcagaaaaagaagtgagttattcactagacagcggtgtttat
acaaatctttataagggctccacagtaactgggagcgattccataaagcttagtggctat
gaattctgctggctaaaaaccaaaaattacagggaggaacaaaaatga

DBGET integrated database retrieval system