KEGG   Mycobacterium africanum: MAF_11040Help
Entry
MAF_11040         CDS       T01575                                 

Gene name
celA2a
Definition
cellulase (EC:3.2.1.4)
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
maf  Mycobacterium africanum
Pathway
Starch and sucrose metabolism
Metabolic pathways
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:maf00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1213011..1213115
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system