KEGG   Mycobacterium africanum: tRNA-Ala-3Help
Entry
tRNA-Ala-3        tRNA      T01575                                 

Gene name
tRNA-Ala(GGC)
Definition
(GenBank) tRNA-Ala
  KO
K14218  
tRNA Ala
Organism
maf  Mycobacterium africanum
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:maf00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    tRNA-Ala-3 (tRNA-Ala(GGC))
Non-coding RNAs [BR:maf03100]
 Transfer RNA
  tRNA
   tRNA-Ala-3 (tRNA-Ala(GGC))
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(3410834..3410906)
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
ggggctatggcgcagctggtagcgcaccacactggcagtgtgggggtcaggggttcgagt
ccccttagctcca

DBGET integrated database retrieval system