KEGG   Micromonospora aurantiaca: Micau_4198Help
Entry
Micau_4198        CDS       T01296                                 

Definition
(GenBank) ROK family protein
  KO
K00845  glucokinase [EC:2.7.1.2]
Organism
mau  Micromonospora aurantiaca
Pathway
mau00010  Glycolysis / Gluconeogenesis
mau00052  Galactose metabolism
mau00500  Starch and sucrose metabolism
mau00520  Amino sugar and nucleotide sugar metabolism
mau00521  Streptomycin biosynthesis
mau01100  Metabolic pathways
mau01110  Biosynthesis of secondary metabolites
mau01120  Microbial metabolism in diverse environments
mau01130  Biosynthesis of antibiotics
mau01200  Carbon metabolism
Module
mau_M00549  Nucleotide sugar biosynthesis, glucose => UDP-glucose
Brite
KEGG Orthology (KO) [BR:mau00001]
 Metabolism
  Carbohydrate metabolism
   00010 Glycolysis / Gluconeogenesis
    Micau_4198
   00052 Galactose metabolism
    Micau_4198
   00500 Starch and sucrose metabolism
    Micau_4198
   00520 Amino sugar and nucleotide sugar metabolism
    Micau_4198
  Biosynthesis of other secondary metabolites
   00521 Streptomycin biosynthesis
    Micau_4198
   00524 Neomycin, kanamycin and gentamicin biosynthesis
    Micau_4198
Enzymes [BR:mau01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.1  Phosphotransferases with an alcohol group as acceptor
    2.7.1.2  glucokinase
     Micau_4198
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: ROK BcrAD_BadFG DUF4126
Motif
Other DBs
NCBI-ProteinID: ADL47711
JGI: Micau_4198
UniProt: D9T3N2
Position
4762909..4763829
Genome map
AA seq 306 aa AA seqDB search
MTGPVVGIDIGGTKTAAALVGPGARVLGRREAPTPARGGPAAVLDTAAGLAADLLAAAGP
GPVGVGTAGTVDPATGVIRYATDSLPGWAGTPVADELAARLGRPVRVTNDVAAAALGECW
AGAGQGRGHVLLAAVGTGLGGAIVNDGRVEGGARGAAGQLGHLPAPGAQRLRCGCGRYGH
LEAIASGTGLAAAYALAGGDPVTGREVARRAAAGDATARQVVDRAGAALGAALAGLVALL
DPDAVVVAGGAAATVLPAATAAYRAELPGGWAHVPLLSAALGADAVVVGAARLATAPIHH
DGGTST
NT seq 921 nt NT seq  +upstreamnt  +downstreamnt
atgaccggtccggtcgtcgggatcgacatcggcggcaccaagaccgccgccgccctggtc
ggtcccggtgcgcgggtgctcggccgccgcgaggcgcccacccccgcgcgcggcgggccg
gccgcggtgctggacaccgccgccggcctggccgcggacctgctcgccgccgccggcccc
gggccggtcggggtgggcaccgcgggcaccgtggacccggcgaccggcgtcatccggtac
gcgaccgacagcctgcccggatgggccggcaccccggtcgcggacgagctggccgcgcgg
ctgggccggccggtgcgcgtcaccaacgacgtcgccgcggcggcgctcggcgagtgctgg
gccggcgccggacagggccgggggcacgtgctgctggccgccgtcggcaccggcctgggc
ggcgcgatcgtcaacgacgggcgggtcgagggcggcgcccggggcgcggccggccagctc
gggcacctgccggcaccgggcgcacagcggctgcgctgcggctgcggccggtacgggcac
ctggaggcgatcgcctccggcaccggcctggccgccgcgtacgcgctcgccggcggtgac
ccggtcaccggccgggaggtggcgcggcgcgcggcggccggtgacgcgacagcccggcag
gtcgtcgaccgggccggcgccgcgctcggcgcggccctggccgggctcgtcgccctgctc
gacccggacgcggtggtggtcgcgggcggcgccgccgccacagtgcttcccgccgcgacg
gccgcctaccgggcggagctaccaggcggctgggcgcacgtgccgctgctttccgcggcg
ctgggcgccgacgcggtggtggtcggcgccgcccggctcgccaccgcaccgatccaccac
gacggaggaacaagcacgtga

DBGET integrated database retrieval system