KEGG   Mycobacterium bovis BCG Korea 1168P: K60_011730Help
Entry
K60_011730        CDS       T02451                                 

Definition
celA2a
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mbk  Mycobacterium bovis BCG Korea 1168P
Pathway
Starch and sucrose metabolism
Metabolic pathways
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:mbk00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1217275..1217379
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system