KEGG   Mycobacterium bovis BCG Tokyo 172: JTY_1122Help
Entry
JTY_1122          CDS       T00864                                 

Gene name
celA2a
Definition
cellulase (EC:3.2.1.4)
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mbt  Mycobacterium bovis BCG Tokyo 172
Pathway
Starch and sucrose metabolism
Metabolic pathways
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:mbt00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1218280..1218384
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system