KEGG   Mycobacterium canettii CIPT 140010059: MCAN_10981Help
Entry
MCAN_10981        CDS       T01585                                 

Gene name
celA2a
Definition
putative cellulase CELA2A
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mce  Mycobacterium canettii CIPT 140010059
Pathway
Starch and sucrose metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:mce00001]
 Metabolism
  Carbohydrate metabolism
   00500 Starch and sucrose metabolism
    MCAN_10981 (celA2a)
Enzymes [BR:mce01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.4  cellulase
     MCAN_10981 (celA2a)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1232387..1232491
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctattga

DBGET integrated database retrieval system