KEGG   Mycobacterium canettii CIPT 140060008: BN44_10170Help
Entry
BN44_10170        CDS       T02419                                 

Definition
(GenBank) Putative DNA glycosylase
Organism
mcq  Mycobacterium canettii CIPT 140060008
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
Position
173282..174208
Genome map
AA seq 308 aa AA seqDB search
MRSIDVVVEAVVTFAGAAGFAHTLAPLRRGQQDPCFRVPGDGTIWRTSLLPTGPVTARIS
RAGRDAARCVAWGSGAEEFVDMAPAMLGAADDASDFVPRHPAVAAAHRRLPNLRLGRTGQ
VLEALIPAVIEQRVPGADAFRSWRLLVSKYGTQAPGPAPPGMRVPPSAEVWRHIPSWEFH
RANVDPGRARAVVGCAQRAASLERLVSLPAARAAEALTSLPGVGVWTAAETTQRVFGDAD
AVSVGDYHIPKMIGWTLVGRPVDDAGMLELLEPMRPHRHRVVRLLEASGLAREPRRGPRL
PVQNIRAL
NT seq 927 nt NT seq  +upstreamnt  +downstreamnt
gtgcggtcaattgacgtggtcgtcgaagcggtggtcaccttcgcgggggcggccggcttc
gcgcacaccttggcgccgttgcgtcgcggtcagcaggatccatgctttcgggtccccggt
gacggcactatctggcggaccagcttgctgcccaccgggccggtcaccgcgcggatcagc
cgtgctgggcgcgacgccgcccgttgcgtggcgtggggcagcggtgccgaggagtttgtc
gacatggcgcccgccatgctgggcgccgccgacgacgctagcgatttcgtgccgcggcat
ccggccgtggccgccgcgcaccgccggctgccgaacttgcgcctgggccgcaccggccag
gtgctggaagccttgatcccggcggtcatcgagcagcgggtacccggcgccgacgcgttt
cggtcgtggcggctgttggtgtccaagtacggaacgcaggcccccggtccggcgccaccc
ggcatgcgggtgccgccgtcggccgaggtgtggcgtcacatcccgtcctgggagtttcat
cgcgccaatgtcgacccggggcgggctcgcgcggtggtgggttgcgcgcagcgggcggcg
tcgctggagcggctggtgtcgctgcccgcggctcgggcggcggaggcgctgacatcgttg
cctggagtcggggtatggaccgcggccgagaccacacaacgcgtgttcggtgacgccgac
gccgtgtcggtcggcgactaccacattccgaagatgatcggctggacgcttgtgggccgg
ccggtcgacgacgccggcatgctcgagctgctggagccgatgcgcccgcatcgccaccgg
gtggtccgcttgctcgaagccagcggcttggcgcgtgagccgcgccgcgggccccggctg
ccggtacagaacatccgggcgctgtag

DBGET integrated database retrieval system