KEGG   Mycobacterium canettii CIPT 140060008: BN44_10186Help
Entry
BN44_10186        gene      T02419                                 

Gene name
pntAb
Definition
(GenBank) pseudogene
Organism
mcq  Mycobacterium canettii CIPT 140060008
SSDB OrthologParalogGene clusterGFIT
Position
190289..190621
Genome map
NT seq 333 nt NT seq  +upstreamnt  +downstreamnt
atgtacaacgaattgttggagaacgtggcgatcctggtgctgtccggattcgtcgggttc
gcggtgatctcgaaagtgcccaacacgttgcacaccccgctgatgtcaggaaccaacgcc
atccacggcattgtcgttctcggcgcgctggtggtcttcggcgaaattgagcacccatcg
ctcgtgttgcaggtcatcctgttcgtcgcggtggtgttcggcacgctgaacgtcatcggc
ggattcatcgtcaccgaccgaatgctcggcatgttcaaggccaagaagcccgccgtgcca
gccaagcctgaccgcgacgaggcgctccgatga

DBGET integrated database retrieval system