KEGG   Monodelphis domestica (opossum): 100029984Help
Entry
100029984         misc_RNA  T01031                                 

Gene name
AOX3
Definition
(RefSeq) aldehyde oxidase 3
Organism
mdo  Monodelphis domestica (opossum)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
Position
4
NT seq 1867 nt NT seq  +upstreamnt  +downstreamnt
aaagagcccttatacagtgccaagaagcataagattccacaagatgaccccacgtcctat
aagccttggtccatctctgtagcctaatgcttgagttccagaagatgacataactatctg
atgaatttaaagactgccattcaccaatataaatgtttctgtttttaaatccatagaaaa
aatatttaattcttaaatacagttatacttactttagtaatcttagaatctcaaaatgca
taagcaattaaacttttttcctattaaaactttaaataaaatcttactttttaatatatt
attttttaattatgctaatggaaaaatgagtagtatttggccaggtaaataaaagagaaa
aaggagatatgaaactcattgctattttttaagtaaagttgtgagaatagaaaacaagtt
attttcttataactagtaaaaatttccatgtgatatcattaaaatgaactgtttcagttg
aatttttcttttgcaaacttggagaatgtgttaaggagagcaaactaatgcagcaagaac
agccagtcagaagtccaaattataggaatcattacctttattactgactagcggggtggc
cccagaggtgagggagagggaagtatactaaaggaaggaattggtagttttcaacacagc
atacatatgtgtctttattaggattctgcagagcaagcaagcaataaatcacagaggtag
actttatacttttaacaacttctcaggatttcagtgtttatcattgggggggttggggtg
ggggggtattagtcctgccataaatttaaccctagggtagactgtgtctgaattcgtggg
gaaacctgcagctttcagaggagaccagcaggcattggctgaaaatgtggtttttgtttc
cttccctgaaggcttcctggacatgcctaggactgggggtttttgtctgcctcaaatgat
tatttaaaaaatcccaaaattttgccttttatgttaggattaatattaagtatgggttcc
aagacacaagagtggaaaaggctaagcaactgagttcaaatgagttgtccacggtagtgg
ttaggaagtatctgagatgagataagaacccaagacctcctatctttaggcctgactctc
taccaccactccataaagaaaacttctctgactgggaattgaacctataatttcattata
taacatatataattaaactctatgggacaatatatagtttttgtttacatgtgttttctg
ttcctgttattgatttcctcaacaaaatttcatagacatatccatttatacagtaagagt
gagactttaagataataatttcatgtcatgtttaaaattatggttttaagaaaataaggt
tttgcctattaaatatattattaatgcctctgtctttaagttaatcttatacctcctttc
aaattgaactctttattaagacaaacaaaaactgaagcaaaaacatctaatagaaagaat
gtccaatcctatctataatcagagaggaaggaaatatgactcattatctcttctttagag
tcttctctaatttttctactaagtagagttcaacatcttgttggtgatctttatattaca
ctggtcattgtgtttattgttcttttagttatgcctcttcttgtactatatttgttcatt
ttccatttttttaaaaacagaaaagtggaaagtaaatcttggtcacaatatatacattga
agaagttcttgggaaatgtgtgtaaaatgtatacattcaagtatattcaagtataccaga
taatttaaatgcaatgaaaacagtagaagagaaagagactaattaggaataaataatatt
ctctcga

DBGET integrated database retrieval system