KEGG   Mannheimia haemolytica USDA-ARS-USMARC-183: D650_17830Help
Entry
D650_17830        gene      T02523                                 

Definition
(GenBank) pseudogene
Organism
mhq  Mannheimia haemolytica USDA-ARS-USMARC-183
SSDB OrthologParalogGene clusterGFIT
Position
1720619..1721703
Genome map
NT seq 1085 nt NT seq  +upstreamnt  +downstreamnt
atgtcaaaaactatcgtgataaaatttggcaccagcactctcacacacggcactaaaagt
ttaagccgtccttatatgttagagctggtaaagctcaattacaccaacagcatcgtgtga
ttgtggtgacatccggagctgccgctgccggtcgggactatttaggacaccctgaactcc
ctaaaaccttagcctctaagcaaatgttagcagcggtcgggcaaagtcagctcattcgag
tgtgggaaaatttattcgatatttataatatccatatcgggcagatgctcttaacccgag
ccgatctggacgatcgtgaacgtttcctcaatgcccgtgatacccttgatgccctgcttg
cacaaaaaatcattccggtgattaatgaaaacgatgccgttgctaccgaagaatttaaag
taggcgataacgataatttatcggctttagttgcgattttggctcaagcagatcagctct
atttattaaccgaccaagaaggcttattcagtgccgatcctcgctcaaaccctgatgcta
aattgctctcggtggtggaaaaaatcacgcctgaaatccgccaaattgccggtggtagtt
caaccggtttaggcacgggcggaatgagtaccaaaattactgctgctgatattgctaccc
gctccggtgtggaaaccatcatcgcctccggttctcgcccaaatgtgttagttgatttag
caaacgggcaaaacatcggcagtaaatttttagtccaatctgaccgcttggaaggcagaa
aacgctggttatttgctgctccgcaagtgggtgaaattgtggtagatttcggggcggaac
aagccttgcttcaacataaatcattactgccggtgggagtttctgccatcaaaggcgaat
ttactcgaggtgaagtaatcaaaattttcagccaagacggcaaagccttagcactcggca
ttgcccgttatagcagtgaggcattgctgcgaattaaaggtaagaaatcaaaagaaattg
aatcgctccttggttatgaatttggttctgttgcagtgcatagtgacgaaatggtggtgt
attaa

DBGET integrated database retrieval system