KEGG   Mannheimia haemolytica USDA-ARS-USMARC-185: D648_9740Help
Entry
D648_9740         gene      T02522                                 

Definition
(GenBank) pseudogene
Organism
mht  Mannheimia haemolytica USDA-ARS-USMARC-185
SSDB OrthologParalogGene clusterGFIT
Position
1574540..1575624
Genome map
NT seq 1085 nt NT seq  +upstreamnt  +downstreamnt
atgtcaaaaactatcgtgataaaatttggcaccagcactctcacacacggcactaaaagt
ttaagccgtccttatatgttagagctggtaaagctcaattacaccaacagcatcgtgtga
ttgtggtgacatccggagctgccgctgccggtcgggactatttaggacaccctgaactcc
ctaaaaccttagcctctaagcaaatgttagcagcggtcgggcaaagtcagctcattcgag
tgtgggaaaatttattcgatatttataatatccatatcgggcagatgctcttaacccgag
ccgatctggacgatcgtgaacgtttcctcaatgcccgtgatacccttgatgccctgcttg
cacaaaaaatcattccggtgattaatgaaaacgatgccgttgctaccgaagaatttaaag
taggcgataacgataatttatcggctttagttgcgattttggctcaagcagatcagctct
atttattaaccgaccaagaaggcttattcagtgccgatcctcgctcaaaccctgatgcta
aattgctctcggtggtggaaaaaatcacgcctgaaatccgccaaattgccggtggtagtt
caaccggtttaggcacgggcggaatgagtaccaaaattactgctgctgatattgctaccc
gctccggtgtggaaaccatcatcgcctccggttctcgcccaaatgtgttagttgatttag
caaacgggcaaaacatcggcagtaaatttttagtccaatctgaccgcttggaaggcagaa
aacgctggttatttgctgctccgcaagtgggtgaaattgtggtagatttcggggcggaac
aagccttgcttcaacataaatcattactgccggtgggagtttctgccatcaaaggcgaat
ttactcgaggtgaagtaatcaaaattttcagccaagacggcaaagccttagcactcggca
ttgcccgttatagcagtgaggcattgctgcgaattaaaggtaagaaatcaaaagaaattg
aatcgctccttggttatgaatttggttctgttgcagtgcatagtgacgaaatggtggtgt
attaa

DBGET integrated database retrieval system