KEGG   Methanospirillum hungatei: Mhun_0209Help
Entry
Mhun_0209         gene      T00325                                 

Definition
(GenBank) pseudogene
Organism
mhu  Methanospirillum hungatei
SSDB OrthologParalogGene clusterGFIT
Position
234381..235090
Genome map
NT seq 710 nt NT seq  +upstreamnt  +downstreamnt
cgggaaaaacctaaaccgagaaagcaaggattatccgctcttgatatcccccagcttgcg
caagccagtggccatcaagtcggatattctaatgtgaagaaggtcgtttatgaatggaag
cattctaatgataaacgtaatatatgtgctctttaagatccccctaaaggacattgaact
gaatttgactgggcatacgcttatgttgtaattcatggttcattacgaaagatccctctg
gcaatcttcattttgaattttagtccgtatcgatttggaaaactctatccctcacaaacc
acttttgacgttattcaggcacacgtcggtttttttcatttgttggagcagtaccacaga
caatcctctgtgacaatgccataaccatttatggtagacggacagatcgatataattctt
cctttcttttatgtgctactcattatggatttgaacctaaagtctgtgtttgtgcgagtc
agcatgagataggtagttgtgagaaatcgatctctgttattcgtagaacagaattatgtg
aaaaaatgcagtttgaaccactcgatgaagataagctccatctgataagcagtcttaata
gtcttaatcgctacccggtctatcgtcgaacaaagatgtcgattcaacttttagaagatg
agggcctatctgctacctctgccggcattactataatattcgaattatga

DBGET integrated database retrieval system