KEGG   Mannheimia haemolytica M42548: MHH_c15770Help
Entry
MHH_c15770        gene      T02635                                 

Gene name
proB2
Definition
(GenBank) pseudogene
Organism
mhx  Mannheimia haemolytica M42548
SSDB OrthologParalogGene clusterGFIT
Position
complement(1503534..1504654)
Genome map
NT seq 1121 nt NT seq  +upstreamnt  +downstreamnt
ttggcaacattatttttagttacaagtgaacagattatgtcaaaaactatcgtgataaaa
tttggcaccagcactctcacacacggcactaaaagtttaagccgtccttatatgttagag
ctggtaaagctcaattacaccaacagcatcgtgtgattgtggtgacatccggagctgccg
ctgccggtcgggactatttaggacaccctgaactccctaaaaccttagcctctaagcaaa
tgttagcagcggtcgggcaaagtcagctcattcgagtgtgggaaaatttattcgatattt
ataatatccatatcgggcagatgctcttaacccgagccgatctggacgatcgtgaacgtt
tcctcaatgcccgtgatacccttgatgccctgcttgcacaaaaaatcattccggtgatta
atgaaaacgatgccgttgctaccgaagaatttaaagtaggcgataacgataatttatcgg
ctttagttgcgattttggctcaagcagatcagctctatttattaaccgaccaagaaggct
tattcagtgccgatcctcgctcaaaccctgatgctaaattgctctcggtggtggaaaaaa
tcacgcctgaaatccgccaaattgccggtggtagttcaaccggtttaggcacgggcggaa
tgagtaccaaaattactgctgctgatattgctacccgctccggtgtggaaaccatcatcg
cctccggttctcgcccaaatgtgttagttgatttagcaaacgggcaaaacatcggcagta
aatttttagtccaatctgaccgcttggaaggcagaaaacgctggttatttgctgctccgc
aagtgggtgaaattgtggtagatttcggggcggaacaagccttgcttcaacataaatcat
tactgccggtgggagtttctgccatcaaaggcgaatttactcgaggtgaagtaatcaaaa
ttttcagccaagacggcaaagccttagcactcggcattgcccgttatagcagtgaggcat
tgctgcgaattaaaggtaagaaatcaaaagaaattgaatcgctccttggttatgaatttg
gttctgttgcagtgcatagtgacgaaatggtggtgtattaa

DBGET integrated database retrieval system