KEGG   Methanocaldococcus infernus: Metin_R0010Help
Entry
Metin_R0010       tRNA      T01234                                 

Definition
tRNA-Pro
Orthology
K14232  
tRNA Pro
Organism
mif  Methanocaldococcus infernus
Pathway
Aminoacyl-tRNA biosynthesis
Class
Genetic Information Processing; Translation; Aminoacyl-tRNA biosynthesis [PATH:mif00970]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
complement(627543..627619)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
ggggccgtggggtagcctggttatcctgtgcgcttggggggcgtgcgacccgggttcaag
tcccggcggccccacca

DBGET integrated database retrieval system