KEGG   Methanopyrus kandleri: MK0107Help
Entry
MK0107            CDS       T00078                                 

Definition
(GenBank) Predicted diverged member of adenylate cyclase 3 family
Organism
mka  Methanopyrus kandleri
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AAM01324
UniProt: Q8TZ32
Position
complement(101154..102512)
Genome map
AA seq 452 aa AA seqDB search
MIHPSRLFVKLSASPRVDGEIVACGTKYDPITEEEREIVETLNSMYMLLTRFEGYPLPAP
QVISNELGEVAEELRREGFGLTKIEQFKYDDPEVALVSKIVLDETRYVYCTYRNENDLQS
LAHECQCTVLECGGGEATVEAPSKFHALRFAVQVPLRLHGSAAIGLTQAAATERFAKAER
HADSEFAAFSKIGAEWIIHRGGDPLPPPRRTNTAPDRILYLDIVGSSELVRERGRRYLEG
IMSRVIDVINEEEGVVLDHRRGGDDVIARFPTKSRALRAAIKIVGRLTEDDVKIKIGIGD
SRGRAAENAVTVRERVDYDCSYIAFRFGPYLVAYVEPPDYAVRIFGRIPSESVRAVGASA
IVGSLTALHPYLALPFFVYFPIAAAHRNRDSASVAVVWFLIWVLVTLSAAWFGLYVREHY
LPRPLVLEMNALFSQLMNLAKTMAARAGAGTP
NT seq 1359 nt NT seq  +upstreamnt  +downstreamnt
atgattcacccctcacgcctattcgtgaaactctcggcctccccgcgggtcgatggggag
atcgtcgcctgcggtaccaagtacgacccgatcaccgaggaggagcgggaaatagtggaa
acgctcaactccatgtacatgctactaacgcgcttcgagggataccctctaccggctccc
caggtaatctccaacgagctcggtgaggtggcggaggagctacgacgcgaagggttcgga
ctgacgaagatagaacaattcaagtacgacgacccggaggtggcgctcgtcagcaagata
gtgctggatgaaaccagatacgtgtattgcacatacaggaacgagaacgacctccagtcg
ctcgcccacgagtgccaatgtaccgtgctggagtgcggaggaggcgaggcgaccgtggaa
gccccctctaaattccacgcactacgattcgcggttcaagtcccactgcggctgcatggt
agcgccgctatcggtctcacccaggccgctgccaccgaacggttcgccaaggccgaacgt
cacgccgactccgagttcgccgcgttctccaagatcggggcggagtggatcatccaccgg
ggtggtgacccgcttcccccaccccgccgaaccaacaccgcgcccgaccgtatcctctac
ctagatatcgttgggtcctccgagctagtccgcgagcgcggacgtcggtatctggagggt
ataatgagcagggtaatcgacgtgatcaacgaggaagaaggggtcgtactggaccatcgc
aggggaggggacgacgtaatagcccggttccccaccaaaagccgggcgctgagggccgcg
atcaagatcgtgggtcggctaacggaagacgacgtcaagataaagatcgggataggcgac
tcaaggggtcgcgccgccgaaaacgctgtaacggtccgtgagcgtgtcgactacgactgc
tcgtacatagcattccgcttcggaccctacctcgtggcgtacgtggaaccacccgactac
gccgtcaggatattcgggcgcatcccgtccgagtccgtccgtgccgtcggcgcgtcggcc
atcgtaggttccctaacagccttacatccgtacctggcactgccgtttttcgtatacttc
ccgatcgcagccgcccataggaaccgtgattcggcatccgtcgccgtggtgtggttcctg
atctgggtcctcgtaacgttatcagccgcttggttcggactgtacgtccgggagcactac
ctaccgcgaccgttggtcctcgaaatgaacgcgttgttctcacaactcatgaacttggct
aagaccatggcagcgcgggcaggggcaggtacgccgtga

DBGET integrated database retrieval system