KEGG   Maricaulis maris: Mmar10_1655Help
Entry
Mmar10_1655       CDS       T00394                                 

Definition
fatty acid desaturase
Orthology
K00507  
stearoyl-CoA desaturase (delta-9 desaturase) [EC:1.14.19.1]
Organism
mmr  Maricaulis maris
Pathway
Biosynthesis of unsaturated fatty acids
Fatty acid metabolism
Class
Metabolism; Overview; Fatty acid metabolism [PATH:mmr01212]
Metabolism; Lipid metabolism; Biosynthesis of unsaturated fatty acids [PATH:mmr01040]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
complement(1814094..1815002)
Genome map
AA seq 302 aa AA seqDB search
MTLESRILARSEAILRSWRTLNWASAFSAIIYPALGVALLTTMIILGLALGGLTLRWWYA
PLCFGVTALTIFLCNMGIGPLHRIWQHRAGEIKWPGQVIIMINCILAMQGTLKDWVNYHS
QHHRFADKPGDPHNPFESKVWAWVGWILWRDEQDLARPMPMWLKDNPVVHFADRFHITLS
LVMHFAIPAVIYLIVALSGGSLILTALIHASVIIGRGLQFHATTLGVNVFGHMKTPKWFD
YLLALLTGGEALHDHHHDFPRSALHLPKKGFWNRVVDYNGTALLVMRRLGLAKNLEIAPQ
FA
NT seq 909 nt NT seq  +upstreamnt  +downstreamnt
atgacccttgaatcccgcattctggcgcgctccgaagcgatcctgagatcctggcgcacc
ctcaactgggcgagtgcgttttcagcaatcatctacccagccctgggtgtggccttgctg
acaaccatgatcatcctcggtctggcgcttggcggcctgaccctgcgatggtggtatgcg
ccactctgctttggtgtcaccgccctgacgatcttcctgtgcaatatgggaatcggcccg
ctgcaccggatctggcagcaccgcgccggcgagatcaaatggcccggccaggtcatcatc
atgatcaattgcatcctcgccatgcagggcacgctgaaggattgggtgaattaccactcg
cagcatcaccgttttgccgacaagccgggtgatccgcacaacccgttcgaatcgaaagtc
tgggcctgggtcggctggatcctgtggcgcgacgagcaggacctcgcccgtccgatgccg
atgtggctgaaggacaacccggtcgtccatttcgctgaccgcttccacatcaccctgtcg
ctcgtcatgcatttcgccatcccggccgtgatctatctgatcgtcgcgctgagcggtggc
tcgctgatcctgacggccctgatccatgccagtgtgatcattggtcgcggcttgcaattc
cacgccaccacgctgggtgtgaacgtcttcggtcacatgaaaacgccgaaatggttcgac
tatctcctggccctgctcaccggtggtgaagcccttcacgaccatcaccacgatttcccg
cgctcggccctccacctgcccaagaagggcttctggaacagggttgtggactataacggc
actgcgcttctggtgatgcgccgcctgggtctcgccaaaaatctcgagatcgcgcctcag
ttcgcctga

DBGET integrated database retrieval system