KEGG   Mus musculus (mouse): 12866Help
Entry
12866             CDS       T01002                                 

Gene name
Cox7a2, COX7AL, Cox7a3, CoxVIIa-L
Definition
(RefSeq) cytochrome c oxidase subunit VIIa 2 (EC:1.9.3.1)
  KO
K02270  
cytochrome c oxidase subunit 7a
Organism
mmu  Mus musculus (mouse)
Pathway
Oxidative phosphorylation
Cardiac muscle contraction
Non-alcoholic fatty liver disease (NAFLD)
Alzheimer's disease
Parkinson's disease
Huntington's disease
Module
Cytochrome c oxidase
Brite
KEGG Orthology (KO) [BR:mmu00001]
 Metabolism
  Energy metabolism
   00190 Oxidative phosphorylation
    12866 (Cox7a2)
 Organismal Systems
  Circulatory system
   04260 Cardiac muscle contraction
    12866 (Cox7a2)
 Human Diseases
  Neurodegenerative diseases
   05010 Alzheimer's disease
    12866 (Cox7a2)
   05012 Parkinson's disease
    12866 (Cox7a2)
   05016 Huntington's disease
    12866 (Cox7a2)
  Endocrine and metabolic diseases
   04932 Non-alcoholic fatty liver disease (NAFLD)
    12866 (Cox7a2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Motif Motif
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
MGI: 
Ensembl: 
UniProt: 
Position
9 E1; 9 43.82 cM
AA seq 83 aa AA seqDB search
MLRNLLALRQIAQRTISTTSRRHFENKVPEKQKLFQEDNGMPVHLKGGASDALLYRATMA
LTLGGTAYAIYLLAMAAFPKKQN
NT seq 252 nt NT seq  +upstreamnt  +downstreamnt
atgttgcggaatctgctggcccttcgtcagattgcccagaggaccatcagcaccacttca
cgaaggcattttgaaaacaaggttccagagaaacaaaagctgtttcaggaggataatggg
atgccagttcatctgaaaggcggggcatctgatgccctcctctacagagccacaatggct
ctgacgcttggtggcacagcctatgccatctatctgttagctatggctgcatttcccaag
aagcagaactaa

DBGET integrated database retrieval system